cas13d coding sequence Search Results


90
Addgene inc cas13d coding sequence
( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the <t>CRISPR/Cas13d</t> vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.
Cas13d Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas13d coding sequence/product/Addgene inc
Average 90 stars, based on 1 article reviews
cas13d coding sequence - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the one-vector CRISPR/Cas13b/d system construct (top) and the EGFP reporter construct (bottom). ( B ) Schematic of type VI-d (left) and VI-b (right) crRNA structures with the target RNA. The crRNAs carry a direct repeat sequence (blue) to facilitate the binding with their corresponding Cas13 enzyme, and a spacer sequence (red) specific for the target RNA, r(GGGGCC) n (purple). ( C and D ) The knockdown efficiency test in HEK293 cells via cotransfection of the CRISPR/Cas13d vector ( C ), or the CRISPR/Cas13b vector ( D ), and the reporter construct. Immunoblotting of EGFP showed the knockdown efficiency for different guide RNAs (gRNAs). Data are presented as means ± SD of 3 independent experiments and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Plasmid Preparation, CRISPR, Construct, Sequencing, Binding Assay, Knockdown, Cotransfection, Western Blot, Comparison

( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of the inducible luciferase-based C9orf72 RAN translation reporter system in HeLa Flp-In cells. ( B ) The reporter cells stably expressing Cas13d and gRNA S24 and S30 showed lower signals of NanoLuc and firefly luciferase signal from the (GGGGCC)70-containing reporter transcripts. The significant reduction of the NanoLuc luciferase signal relative to the firefly luciferase signal demonstrates that the repeat-associated RAN translation is inhibited by Cas13d-mediated S24 or S30 treatment. ( C ) The control cells harboring the reporter without the G4C2 repeat showed no effect of the Cas13d gRNAs on the translation of the reporters. ( D ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HeLa RAN translation reporter cell lines stably expressing Cas13d-NT30, Cas13d-S24, and Cs13d-S30. ( E ) Transient cotransfection of CRISPR/Cas13d constructs with either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct in HEK293 cells showed that Cas13d-S24 and Cas13d-S30 significantly reduced both NanoLuc and firefly luciferase signals from the GA-, GP-, and GR-frame but not the negative No-G4C2-repeat control reporter compared with the non-targeting control Cas13d-NT30. ( F ) Immunoblot analysis of C9orf72 protein showed that the C9orf72 protein level was unaffected in HEK293 cells cotransfected with CRISPR/Cas13d and either the GA-frame, GP-frame, or GR-frame or the No-G4C2-repeat control construct. Data are presented as means ± SD of 3 or 4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Luciferase, Stable Transfection, Expressing, Control, Western Blot, Cotransfection, CRISPR, Construct, Comparison

( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of RAN translation product detection in human iPSCs stably expressing Cas13d and gRNA via lentivirus transduction. ( B ) ELISA quantification in multiple C9-ALS patient iPSC cell lines showed significant reduction of poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( C ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iPSC cell lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( D and E ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( D ) and poly-GA ( E ) knockdown efficiency among C9-ALS patient iPSC lines. Pearson’s correlation coefficients and 2-tailed P value were computed. ( F ) Schematic of poly-GP and poly-GA detection in iMNs derived from human C9-ALS patient iPSCs. ( G ) ELISA quantification in iMN lines derived from multiple iPSC cell lines showed significant reduction in poly-GP and poly-GA levels by Cas13d-S24 and CRISPR/S30 compared with the non-targeting control Cas13d-NT30. ( H ) Quantification of relative RNA levels of Cas13d in the C9-ALS patient iMN lines showed variable Cas13d levels among lines, while in each line there were no significant differences among the S24, S30, and non-targeting NT30 groups. ( I and J ) Linear regression and correlation analyses showed a strong positive correlation between Cas13d expression level and poly-GP ( I ) and poly-GA ( J ) knockdown efficiency among C9-ALS patient iMN lines. Pearson’s correlation coefficients and 2-tailed P value were computed. Data are presented as means ± SD of 2–4 biological replicates as indicated by the number of dots in each graph, and were analyzed with ordinary 1-way ANOVA with Dunnett’s multiple-comparison test. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Stable Transfection, Expressing, Transduction, Enzyme-linked Immunosorbent Assay, CRISPR, Control, Knockdown, Derivative Assay, Comparison

( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Purified Cas13d showed a nearly 100% degradation efficiency of the target RNA r(NT24) with gRNA NT24 but not the other gRNAs, confirming the specificity and high cleavage activity of the Cas13d system. ( B ) The target RNA r(GGGGCC)2 was too short to be degraded by Cas13d. ( C – E ) The purified Cas13d showed partial degradation of the target RNAs r(GGGGCC)5 ( C ), r(GGGGCC)8 ( D ), and r(GGGGCC)12 ( E ) with gRNA S24 or S30 but not the other gRNAs, indicating a compromised cleavage activity of Cas13d targeting GGGGCC repeat RNAs and a trend of decreased cleavage efficiency with increased repeat lengths. ( F ) Cas13d was unable to degrade r(GGGGCC)28, demonstrating the limited activity of Cas13d to target or cleave longer GGGGCC repeat RNAs. The cleavage assay was performed in a buffer containing 0.3 μM of gRNA, 0.6 μM of Cas13d protein, and 40 ng/μL of target RNA. Data are presented as means ± SD of 3 independent experiments and were analyzed with unpaired 2-tailed Student’s t test ( A ) and ordinary 1-way ANOVA with Dunnett’s multiple-comparison test ( B – F ). * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Purification, Activity Assay, Cleavage Assay, Comparison

( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: CRISPR/Cas13d targeting suppresses repeat-associated non-AUG translation of C9orf72 hexanucleotide repeat RNA

doi: 10.1172/JCI179016

Figure Lengend Snippet: ( A ) Schematic of poly-GP and poly-GA detection in mice treated with AAV9 expressing Cas13d and gRNA. ( B and C ) Quantification showed decreased levels of poly-GP ( B ) or poly-GA ( C ) in C9-500 BAC mice but not in the WT mice, when the mice were treated with AAV9 expressing Cas13d-S24 or Cas13d-S30, compared with those treated with control AAV9 expressing the non-targeting Cas13d-NT30. The number of dots in each group indicates the number of mice in the corresponding group. Data are presented as means ± SD and were analyzed with unpaired 1-tailed Student’s t test. * P < 0.05, **** P < 0.0001.

Article Snippet: Cas13d coding sequence was amplified from a plasmid (Addgene, 109049) using a forward primer introducing an NdeI site (TACCACATATGATCGAAAAAAAAAAGTCCTTCGCCAA) and a reverse primer introducing a BamHI site (TTGCAGGATCCTTAGGAATTGCCGGACACCTTCTTTTTCTC).

Techniques: Expressing, Control